DNA/RNA Lesson

TE 408:
Field Lesson 1 Plan and Report

Name:
Joel Ledvina
Partner:
Jake Porter
Mentor
Teacher: Kelly Carrier
School:
Okemos
Class
and grade level: 10th grade Biology
Date:
2/1/12

 

Part I: Information about the Lesson or Unit

Topic: DNA/RNA

Abstract

In this lesson, our students will be introduced to DNA and
RNA for the first time in detail. They will first participate in a lab activity
where they will map out the history of how DNA was discovered. They will then
be lectured on the structure of DNA, the base pairing rules, the structure of
RNA and what a DNA molecule looks like. The students will also interact using a
polling system where students can use their cell phones to vote on the answers
of questions.

 

Part II: Clarifying Your Goals for the Topic

A.
Big Ideas

There are three main scientists who have greatly contributed
to the discovery of DNA.  Rosalind
Franklin worked with x-ray diffraction to demonstrate that DNA has a helical
shape. Erwin Chargaff who is considered the father of molecular biology
discovered the chemical composition of DNA. He is responsible for discovering
the base pairs and their specific rules. James Watson and Francis Crick put the
information from previous scientists together and created the model of DNA that
is used today.

DNA contains the genetic information for organisms. DNA is
located in our cells and every organism has its own specific DNA. The first
step to understanding DNA is knowing it’s structure. Every DNA molecule is made
up of a phosphate group, a 5-carbon sugar, and a base. Phosphodiester bonds
that create strands of DNA molecules connect these individual parts of DNA. DNA
is made up of two of these strands (I.E- double stranded) that run
anti-parallel to each other. The bases of each strand connect to bases of the
other strand via hydrogen bonds to connect these DNA strands. RNA is similar to
DNA but has a few major differences. RNA is single stranded as opposed to the
double stranded structure of DNA. Also, RNA contains a different base pair than
DNA.

The base pairs of DNA/RNA can be divided into two different
classes. First are the Purines. In both DNA and RNA the purines are adenine and
guanine. Next come the pyrimidine’s. In DNA the pyrimidine’s are thymine and
cytosine. In RNA thymine is substituted for uracil.  There are specific base paring rules that
determine the sequence of every DNA molecule. Adenine will always bond with
thymine via two hydrogen bonds. On the other hand, guanine will always bond
with cytosine via three hydrogen bonds. From these rules, if you were given one
strand of DNA you would be able to figure out it’s complementary strand.

B. Student Practices

1. Naming key practices

The first practice that students will engage in will be
developing models. In the lab activity they will have to draw pictures that
represent specific models of DNA. This lab activity will also engage the
students in discussion and allow for group chatter.

The second practice will be obtaining, evaluating, and using
information. They students will have to obtain information during the lecture
part of our lesson and use this information to answer the homework assignment.
This will also help us in assessing the students understanding.

2. Using practices to make connections

The main practice that we will be using is developing models.
Our students will have to construct a model of DNA based on how the different
scientists believed DNA looked. Through this practice we hope the students will
be able to connect what they make with paper clips to what actual DNA is like.

There are three rules
main rules that the students must follow for this practice to work. First they
model must be supported by data. To do this we will be passing out information
on how specific scientists thought DNA was constructed and they must make their
model accordingly. Next, their model must be as simple as possible. To enforce
this we will be passing out limited material and trying to keep the models
small. This way students will not be tempted to make huge complicated models.
Lastly, each member of the group must validate the model with us to move on to
the next picture.

C. Objectives for Student Learning

 

Objective

Type

Michigan
Objective(s)

  1. B4.2B-
    Recognize that every species has its own characteristic DNA sequence.

 

 Identifying
2. B2.4C- Describe the structure and function of DNA Identifying

Specific
Lesson Objective(s)

1.  Identify
the structure of DNA/RNA
Identifying
2. Identify the base pairs rules Identifying
3.  Using data
to create models of DNA
Using

 

Part III: Classroom Activities

A. Materials

1. Tablet (provided by our mentor teacher) to help us with
our lecture

2. Cell phones- so the students can participate in the poll
everywhere questions

3. The cards the students will be given that has the
information about DNA on it.

 

The cards will have the following information on them:

Card one: Erwin Chargaff Draw
Model

  1. i.
    DNA is a long chain like molecule composed of
    small subunits
  2. ii.
    Subunits molecules are like links in a chain and
    are attached to each other by covalent bonds
  3. iii.
    There are four sub units that were studied by
    Chargaff. Please refer to the information above

Card two: Rosaline Franklin
(5-6 min)

  1. iv.
    DNA has 2 long chains of subunits twisted around
    each other to form a double helix.
  2. v.
    The diameter of DNA is uniform in length.
  3. vi.
    The 2 long chains have a sugar and phosphate
    backbone that alternates between sugars and phosphates.
  4. vii.
    The bases discovered by Chargaff are between the
    2 backbones.

Card
Three:
Model 3: James Watson and Francis Crick (5-6min)

  1. viii.
    DNA contains subunits that re bonded together by
    hydrogen bonds between Adenine and Thymine; Cytosine and Guanine. Each nitrogen
    base subunit is connected to one sugar and one phosphate and this new larger
    subunit is called a nucleotide.
  2. ix.
    The order of the bases in one strand of DNA determines
    the order of subunits of the other strand of DNA.
  3. x.
    DNA can make an exact copy of itself and is the
    blueprint of proteins.
  4. xi.
    Below is an illustration of the bases. How might
    they bond with one another?

 

 

4. Online access so students can complete their online
homework.

B. Activities

1. Introduction (5 minutes)

  1. To start this lesson we will be asking a poll
    everywhere question about what the students already know about DNA. This will
    introduce them to the topic and get them thinking about DNA. I will start by
    saying something along the lines of  “ Yesterday you found that your child has a disorder in your
    case study. (They students will be doing a week long case study about DNA after
    our lesson) All of the disorders are linked to mistakes in DNA. To understand
    how these mistakes might occur we need to understand more about DNA and how it
    works with making proteins and genetics. So we will start with what DNA is and
    what we know about its structure.”
  2. Next we will ask a poll everywhere
    question.  The question will be “What
    does DNA stand for?” We will be giving them 4 choices and they will have to
    text the correct answer.   I believe it
    is important to know this because students will spend a lot of time with DNA
    and knowing what it stands for is important.
  3. Lastly, I will break
    the student into groups by counting off by ten and having the students go to
    their corresponding lab stations. Here they will begin the activity about the
    history of the discovery of DNA.

 

Main Teaching Activities (45 minutes)

         1.
After students are at their lab
stations, I will instruct them to take the first set of information that is at
their tables and draw a picture of DNA based on what is on their card. They are
supposed to forget everything they previously know about DNA in this activity
and draw models according to what they read on the cards. Once they have the
first picture done, I will be checking them off and giving them another card.
This card will have a little more information about DNA and the students will
have to draw another picture based on this new information. Once I check the
group’s pictures for this card, they will be given the final card. This last
card has the information about DNA that is accepted today. They will again have
to draw a picture of this and end with three pictures. The thought process is
that these three pictures represent the progression of the discovery of the
DNA. Also, this will introduce and get them thinking about the structure of
DNA.

Next,
we will be lecturing the students on the structure of DNA and a brief
introduction to RNA. The outline of our lecture will be as following:

There are two types of Nucleic
acids.

  1. DNA
    (10-15 min)
  2. RNA
    (5-10 min)

DNA- Deoxyribonucleic acid.  It is
where all of your genetic information is, and is located in your chromosomes.

  1. DNA
    exists in Eukaryotes.
  2. It
    is double stranded. Draw a picture of DNA (not including the double Helix
    aspect)
  3. Structure.
    Draw as you explain the parts & functions.

    1. i.
      Base pairs- formed by the lead strand and the
      antiparallel lagging strand of DNA

      1. Bases-which
        are attached by hydrogen bonds(weaker than covalent or ionic bonds)

        1. Adenine-6
          member & 5 member ring
        2. Guanine-
          6 member & 5 member ring
        3. Cytosine-
          6 member ring
        4. Thymine-
          6 member ring
        5. Purines
          1. Adenine
          2. guanine
          3. Pyrimidine
            1. Cytosine
            2. Thymine
    2. ii.
      Backbone

      1. Phosphate-
        one part of the “backbone” that makes DNA
      2. Sugar-
        Along with Phosphate makes up the DNA “backbone”

RNA- exists in Eukaryotes and Prokaryotes

  1. Single stranded molecule- made similarly to DNA.
    The only difference being the type of sugar used to construct the “backbone”.
  2. Base
    pairs

    1. i.
      Adenine
    2. ii.
      Guanine
    3. iii.
      Cytosine
    4. iv.
      Uracil- RNA contains uracil instead of thymine.
      Is only different by one carbon atom.

 

 

3. Conclusion (5 minutes)

We will be
asking two more polleverywhere questions that ask what organisms have RNA, and
a multiple choice question that will give four properties of DNA and the
students will ask what ones are correct. (In our case all the above will be
correct) We will conclude the class by coming back together and giving a few
final remarks. Then the students will be assigned online homework that they
will complete on Coursekit.

Part IV: Assessment of Focus Students

A. Focus Objective

Interpret the different models of DNA by different scientist,
and be able to reconstruct their models. Identify the history of the discovery
of DNA

Identify the structure of DNA/RNA

 

B. Developing Assessment Task:

Our assessment will consist of
three parts. The first part will be an in class assessment on our lecture. In
this assessment we will be using polleverywhere.com.  This will involve the students using their
cell phones to answer questions that we ask them on the web page. We can
display the results to the answer on the overhead projector and talk about what
the answer was and clear up any mistakes that the students made when answering
the question.

The second part of our assessment
will be a small group assessment in which the students will be given a discovery
about DNA and required to draw a model. After the students read the historic
event of the discovery of DNA they will be given a few minutes to draw a model
of DNA based off this event. Then we will walk around and check off their
model, to make sure they completed it. Then the students will be given another
historic event on the discovery of DNA, and once again will draw a model that
we will walk around and check. Finally they will be given one more event and it
will be that of Watson & Crick, so the final one should be in the form of a
Double helix, have a sugar/phosphate backbone, and have the bases partnered A-T
and C-G. This assessment was provided to us by our mentor teacher. It is the
one that he has used in the past and he wanted us to do it so that he did not
have to find another time to cram it into his scheduling.

The final
Assessment will be on the class’s class webpage CourseKit.com. We will post the
questions on there after our lecture and the students will have until Thursday
night at 11pm to answer them. This will allow us to keep their assessment
answers because they will be stored on the webpage, and will allow the students
to ask us questions about what they didn’t understand in class about DNA and
RNA. We can also post our presentation on this page so the students can go and
look back at what we talked about.

 

  1. 1.
    In Class poll questions.

    1. What
      Does DNA stand for?

      1. Deoxyribonucleic
        acid
      2. Diriribonitric
        acid
      3. Deoxyribonitric
        acid
      4. Diribonucleic
        acid
      5. Which
        of these organisms contain DNA?

        1. Eukaryote
        2. Prokaryote
        3. Both
        4. Which
          of these organisms have RNA?

          1. Eukaryote
          2. Prokaryote
          3. Both
          4. DNA
            is…

            1. Deoxyribonucleic
              acid
            2. Has
              a phosphate and sugar backbone
            3. Is
              stored in chromosomes
            4. Is
              in all eukaryote organisms
            5. All
              of the above
            6. 2.
              In class model building

              1. Rosalind
                Franklin
              2. Erwin
                Chargaff
              3. James
                Watson and Francis crick

 

  1. 3.      Out
    of class questions for the Couse page
  2. If this sequence (5’ATCCAGATGCATTAGGCCATG 3’) is
    one side of a DNA molecule then what would the corresponding sequence be? Make
    sure to label what end is which? TAGGTCTACGTAATCCGGTAC
  1. What molecule is bigger a purine or a
    pyrimidine? Purines are bigger. Because they
    contain two rings where pyrimidine’s only have one.
  2. What three main subunits make up a
    nucleotide? Sugar, Phosphate, Base
  3. What does DNA stand for? What does
    this mean? Deoxyribonucleic acid, backbone does
    not include 2 oxygen molecules only 1.
  4. What does RNA stand for? What does
    this mean? Ribonucleic acid, backbone has 2 oxygen
    molecules.
  5. What nucleic acid is larger DNA or
    RNA? DNA, because it is double stranded
  6. What are the two main differences
    between DNA and RNA? DNA is double stranded/RNA is
    single, DNA has thymine/RNA has Uracil, DNA is in eukaryotes/RNA is in
    eukaryotes and Prokaryotes.

 

 

 

 

Leave a Reply

Your email address will not be published. Required fields are marked *

*

You may use these HTML tags and attributes: <a href="" title=""> <abbr title=""> <acronym title=""> <b> <blockquote cite=""> <cite> <code> <del datetime=""> <em> <i> <q cite=""> <strike> <strong>